Długoterminowa kontrola HIV przez transplantację komórek macierzystych CCR5 Delta32 / Delta32 ad

Genotypy HLA pacjenta i dawcy były identyczne w następujących loci: A * 0201; B * 0702,3501; Cw * 0401,0702; DRB1 * 0101,1501; i DQB1 * 0501,0602. Pacjent przeszedł reżim kondycjonowania i otrzymał przeszczep zawierający 2,3 x 106 komórek CD34 + na kilogram wagi ciała.5 Profilaktyka przeciwko chorobie przeszczep przeciwko gospodarzowi składała się z 0,5 mg króliczej globuliny antymitocytowej na kilogram 3 dni przed przeszczepem, 2,5 mg na kilogram 2 dni wcześniej i 2,5 mg na kilogram dzień wcześniej. Pacjent otrzymał dwie dawki 2,5 mg cyklosporyny na kilogram dożylnie na dzień przed zabiegiem i rozpoczęto leczenie mykofenolanem mofetilem w dawce g trzy razy na dobę 6 godzin po transplantacji. HAART podawano do dnia poprzedzającego zabieg, a wszczepienie wykonano 13 dni po zabiegu. Z wyjątkiem obecności choroby I typu przeszczep przeciwko gospodarzowi skóry, która była leczona poprzez dostosowanie dawki cyklosporyny, nie wystąpiły żadne poważne infekcje ani efekty toksyczne inne niż stopień I podczas pierwszego roku obserwacji. Ostra białaczka szpikowa nawróciła 332 dni po transplantacji, a chimeryzm przejściowo zmniejszył się do 15%. Pacjentów poddano terapii reindukcyjnej cytarabiną i gemtuzumabem iw dniu 391 otrzymali drugi przeszczep, składający się z 2,1 x 106 komórek CD34 + na kilogram, od tego samego dawcy, po leczeniu pojedynczą dawką naświetlania całego ciała (200 cGy). Druga procedura doprowadziła do całkowitej remisji ostrej białaczki szpikowej, która wciąż była w remisji w 20 miesiącu obserwacji. Metody
Genotypowanie CCR5
Genomowy DNA ekstrahowano z heparynizowanych monocytów krwi obwodowej otrzymanych od pacjenta i przyszłego dawcy, z użyciem zestawu QIAamp Blood Midi Kit (Qiagen). Badanie przesiewowe dawców dla allela delta32 CCR5 przeprowadzono z zastosowaniem testu PCR z genomową reakcją łańcuchową (PCR), ze starterami flankującymi miejsce delecji (do przodu, 5 CTCCCAGGAATCATCTTTACC3 ; odwrotnością, 5 TCATTTCGACACCGAAGCAG3 ), co dało Fragment PCR o wielkości 200 bp dla allelu CCR5 i 168 bp dla delta32 delecji. Wyniki potwierdzono metodą PCR specyficznej dla allelu i metodą bezpośredniego sekwencjonowania za pomocą zestawu do sekwencjonowania cykli BigDye Terminator v1.1 (Applied Biosystems). Sekwencje analizowano za pomocą oprogramowania Vector NTI ContigExpress (Invitrogen).
Genotypowanie wirusowe-kopertowe
Zastosowanie Coreceptora przez HIV-1 oceniano za pomocą sekwencji aminokwasów V3 regionu env zarówno dla DNA, jak i RNA. Produkty masowej reakcji PCR poddano bezpośredniemu sekwencjonowaniu i określono zgodnie z regułami 11/25 i ładowaniem netto, jak opisali Delobel i in. 6
W przypadku RNA region env HIV sekwencjonowano od pozycji 6538 do 6816, a matrycę punktową opartą na specyficznej pozycji w sieci Web (WebPSSM) i oprogramowanie bioinformatyczne geno2pheno zastosowano do przewidywania wirusowego zastosowania koreceptora. Ponadto przeprowadzono ultradepową analizę PCR z sekwencjonowaniem równoległym (454-Life-Sciences, Roche) 7
Receptory chemokin i antygeny powierzchniowe
Komórki śluzówki izolowano z 10 próbek pobranych z biopsji odbytnicy zgodnie z metodą Moos i wsp. [8] Ekspresję CCR5 stymulowano fitohemaglutyniną (Sigma), a komórki analizowano za pomocą cytometrii przepływowej z użyciem przeciwciał przeciwko CD3, CD4, CD11c, CD163 i CCR5 (BD Biosciences).
Chimeryzm
Standardowe analizy chimeryzmu oparto na rozróżnieniu między allelami dawcy i biorcy w krótkich powtórzeniach tandemowych, z wykorzystaniem PCR i starterów znakowanych fluorescencyjnie zgodnie z metodą Blau i wsp.9.
Reakcje odpornościowe komórkowe i humoralne
Wydzielanie interferonu-. przez komórki swoiste dla antygenu indukowano zgodnie z metodą Ganepola i wsp. 10 Do pomiaru odpowiedzi immunologicznych za pośrednictwem komórek T użyto dwa peptydy wiążące HLA-A * 0201: HIV-1476-484. (ILKEPVHGV) i cytomegalowirus (CMV) 65-73 (NLVPMVATV)
[hasła pokrewne: jak radzić sobie z samotnością, dentysta dąbrowa górnicza, test woronowicza ]

Powiązane tematy z artykułem: dentysta dąbrowa górnicza jak radzić sobie z samotnością test woronowicza